Journal of Undergraduate Research
Volume 8, Issue 4 - March / April 2007
Protein-Protein Interactions Regulating Expression of the β-Globin Gene
Archana Anantharaman
ABSTRACT
There are five human β-like globin genes that are expressed in a developmental-, stage-specific manner in erythroid cells. Various ubiquitously expressed and erythroid-specific proteins interact with regulatory DNA elements present in the β-globin locus to control expression of these genes. Previously, it was shown that ubiquitously expressed transcription factors TFII-I and USF interact with initiator and E-box elements present in the β-globin promoter. This study demonstrates that both proteins recruit co-regulatory proteins to the promoter to change the accessibility of chromatin in order to accurately restrict appropriate expression of the β-globin gene.
BACKGROUND
The human and mouse β-globin genes are expressed solely in erythroid cells and located on chromosome 11 and 7, respectively. Both mammalian systems consist of several functional genes which are arranged in order of successive developmental expression (Figure1).1 The ε-globin gene is the first gene to be expressed in the embryonic yolk sac. After six to eight weeks of gestation, hematopoiesis begins to occur in the fetal liver. At this stage, the ε-globin gene is repressed and expression of the γ-globin genes are activated. Shortly after birth, another switch results in the bone marrow being the major site of hematopoiesis, with minor production in the spleen. At this time, the γ-globin genes are repressed and the β-globin gene is activated. The δ-globin gene is also activated, however, it is expressed at levels lower than 5% of the β-globin gene.
Figure 1. Diagrammatic representation of the human β-globin gene locus (above) and the mouse β-globin gene locus. Figures are not drawn to scale1.
The locus control region (LCR), located 6 to 22 kb upstream of the ε-globin gene is required for high-level expression of the β-globin genes in erythroid cells.2 The LCR has a dominant chromatin opening activity and also functions as an enhancer to mediate activation in a position and orientation independent manner in transgenic assays.3 The human β-globin LCR is composed of five domains hypersensitive to DNase I (known as hypersensitive sites or HSs), each with a specific function. Each element of the LCR is comprised of many binding sites for ubiquitous or erythroid-specific transcription factors. It is thought that the LCR recruits various factors to the HSs and transfers them to the β-like globin gene being expressed through a looping, linking, or tracking mechanism.
The β-globin gene promoter has several elements near the transcription start site that interact with ubiquitous or erythroid-specific transcription factors. An initiator element is located near the transcription start site and overlaps with one conserved E-box. A second conserved E-box is located 60 bp 3’ to the transcription initiation start site (Figure 2).4
Figure 2. Sequence alignment of the β-globin gene downstream promoter region in humans (H), mouse (M), and rabbits (R). Regions highlighted in gray represent the positions of E-boxes. The E-box at the initiator and the distal E-box are conserved in all three species.4
The initiator element is known to bind a variety of proteins, especially basic helix-loop-helix proteins, such as TFII-I (Transcription factor II-I) and USF (Upstream Stimulatory Factor). These proteins have been implicated to aid in the recruitment of transcription complexes to TATA-less promoters and stabilize transcription complexes on promoters with TATA-boxes.5,6 It has previously been shown that the β-globin initiator/E-box element interacts with both TFII-I and USF1 proteins, while the +60 E-box binds USF1 and USF2.4 Therefore, these transcription factors may play a role in regulating the stage-specific expression of the β-globin gene.
TFII-I is a ubiquitously expressed, multifunctional protein. It regulates the transcription of various groups of genes by acting either as an activator or repressor of transcription.7-9 It was demonstrated that TFII-I interacts with Histone Deacetylase 3 (HDAC3) embryonic erythroid cells in erythroid cells.10-13 HDACs remove acetyl groups from histone tails found on nucleosomes and interact with corepressor complexes to direct gene-specific transcriptional repression.14 Previous studies have shown that transcriptional repression is exerted by HDAC3 upon TFII-I mediated gene activation when the two proteins are interacting.15
The Polycomb group (PcG) proteins represent another class of highly conserved proteins that are involved in transcriptional repression. They were first identified in Drosophila as repressors of homeotic genes controlling segment identity. PcG proteins function in two distinct complexes, PRC1 and PRC2, whose core components are conserved from fruit flies to humans. PRC1 core components include the proteins Phc1 and Rnf2, and PRC2 consists of Suz12, Ezh2, and Eed. Both complexes function as transcription repressors through epigenetic modifications enforced on chromatin structure. In fact, a PRC2 protein, Suz12, is shown to be associated with trimethylated Lysine 27 on histone H3 of nucleosomes, which is considered a repressive chromatin marker.16,17
USF1 and USF2 interact with the distal +60 E-box on the β-globin promoter in an adult environment to stimulate transcription of the gene.4,18 USF1 and USF2 are members of a family of evolutionary conserved basic helix-loop-helix leucine zipper transcription factors. These proteins are mainly found to interact with high affinity to cognate E-box regulatory elements (CANNTG) and initiator elements.19,20 The USF proteins are most commonly found in a USF1·USF2 heterodimer configuration, while homodimers are rarely found in cells.21 The USF proteins are ubiquitously expressed in eukaryotes and participate in distinct transcriptional processes, mediating recruitment of chromatin remodeling enzymes and interacting with coactivators and members of the transcription pre-initiation complex.19 Perhaps the most prominent coactivators recruited to regulatory DNA elements by USF are the histone acetyltransferases (HATs) CBP (cyclic adenosine monophosphate (cAMP) response element-binding protein (CREB)-binding protein) and p300, which are closely related proteins. HATs acetylate histones H3 and H4, mostly at the N-terminal tails. Increased acetylation of histones is a hallmark of open and accessible chromatin. It is generally believed that many transcription factors activate transcription by the recruitment of HATs that then render promoters accessible for transcription complexes. The HATs CBP and p300 are widely expressed proteins that interact with a large number of transcription factors via dedicated domains, thereby acting as transcriptional regulators.22
The aim of the study was to identify co-regulators associated with USF and TFII-I in erythroid cells and to determine their role in β-globin gene expression. The data demonstrate that USF activates globin gene expression at least in part by recruiting the coactivators and HATs CBP and p300, which render the globin promoter accessible to the transcription complex. TFII-I represses β-globin gene transcription by recruiting HDACs and polycomb group protein complexes, which lead to the formation of an inaccessible chromatin structure around the β-globin promoter.
MATERIALS AND METHODS
The immunoprecipitation and ChIP protocols described below were adapted from Leach, et Al. and Crusselle-Davis, et Al.11,18
Cell Culture
K562 cells are a human embryonic erythroleukemia cell line in which the β-globin gene is repressed and the ε-globin gene is expressed. MEL cells are adult mouse erythroleukemia cells expressing the adult β-globin gene. Both cell lines are suspension cells that are grown in RPMI 1640 medium with L-glutamine. The K562 cells were grown in RPMI medium supplemented with 15% fetal bovine serum and 5% penicillin-streptomycin. MEL cells were grown in a medium containing 10% fetal bovine serum and 5% antibiotic-antimycotic. Cells were grown at 37°C in a 5% CO2 sterile environment at a density between 1 X 105 cells/ml to 5 X 105 cells/ml.
Co-Immunoprecipitation
To immunoprecipitate HDAC3 or Suz12 from cells, 5 X 107 K562 and MEL cells were lysed with 0.5 ml of NP-40 lysis buffer (150mM NaCl, 1% NP-40, 50mM Tris, pH 8.0). The extracts were precleared with 50 μl of anti-rabbit immunoglobulin G (IgG) beads (eBioscience) by mixing for 30 minutes at 4°C. Precipitation was initiated by incubating 5μg or 2.5μg of the desired antibody with the cell lysate for 2.5 hours. Protein-antibody complexes were then captured by incubating the extracts with 50 μl of anti-rabbit IgG beads (eBiosceince) for 2 hours. All incubations in the process were performed by spinning on a wheel at 4°C. The bead-antibody-protein complexes were then spun down at 10,000 rcf for 1 minute at 4°C. They were then washed with 0.5 ml of NP-40 lysis buffer by incubating for 5 minutes in the buffer. This process was repeated two more times. Thereafter, the buffer was aspirated from the bead complexes and proteins were eluted off with Laemmeli buffer (Biorad) containing 5% 2-mercaptoethanol at 95°C for 10 minutes. The eluted samples were then loaded onto a 7.5% Tris Ready gel (Biorad) and run for approximately one hour at 150 V in tank buffer (0.01% SDS, 3g Tris base, 14.4g Glycine for 1L solution). The proteins were then transferred from the gel onto nitrocellulose membranes overnight at 4°C under 30 V in transfer buffer (0.84g Sodium Carbonate, 0.318g Sodium bicarbonate, 20% methanol, pH 9.9 for 1L solution). Membranes were removed from the transfer apparatus and western blotting was performed as described in Davis, et al.18
If analysis with a different primary antibody in the western blotting process was necessary, the membranes were stripped using a stringent stripping buffer (0.7% 2-mercaptoethanol, 2% SDS, 6.25% Tris-HCl pH 6.7). Membranes are fully immersed in the buffer and incubated at 50°C for 30 minutes. Thereafter, the membranes are washed twice with TBS/T by rocking at room temperature for 10 minutes. They are then blocked with 5% milk at room temperature for one hour and the western blotting procedure is continued as stated above from that step onwards.
Chromatin Immunoprecipitation
ChIP assays were conducted using 1 X 107 K562 and MEL cells per antibody. Proteins were crosslinked to DNA in vivo by incubating the cells in 1% formaldehyde by rocking at room temperature for 10 minutes. The crosslinking was quenched with the addition of 0.125M glycine for 5 minutes. Cells were then washed with 1 X PBS (containing protease inhibitors), resuspended in swelling buffer (5 mM PIPES pH 8.0, 85 mM KCl, 0.5% NP-40, 11 mg/ml sodium butyrate, protease inhibitors), and incubated on ice for 10 minutes. The nuclei were then lysed with the addition of a lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris–HCl pH 8.1, 11 mg/ml sodium butyrate, protease inhibitors) and incubated on ice for 10 minutes. The DNA obtained was then sonicated in an ice-water bath to yield an average size of <500bp and cleared by centrifugation. The eluted supernatant was diluted in dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 167 mM Tris–HCl pH 8.1, 167 mM NaCl, 11 mg/ml sodium butyrate, protease inhibitors). Aliquots of 50 µl Protein A–Sepharose beads per ml were added and the diluted lysates were incubated by rotating on a wheel for 2 hours at 4°C to preclear the lysates. The beads were then pelleted and 5 µg of antibody was added to 1ml of the supernatant and allowed to incubate by rotating on a wheel at 4°C overnight. The remainder of the protocol was performed as per instructions in Leach, et al.11 DNA was purified using a purification kit (Qiagen).
Each PCR reaction consisted of 10% input DNA or 10% immunoprecipitated DNA, 50 pM primers and 10 µl SyBr Green Mastermix (BioRad) in a total volume of 20 µl. The following primers were used:
- Human HS2, US:
5’-CGCCTTCTGGTTCTGTGTAA–3’; DS: 5’-GAGAACCATCTGGGCACACAC –3’ - β-globin,
US:
5’- GTCAGGGCAGAGCCATCTAT-3’, DS: 5’- AACGGCAGACTTCTCCTCAG –3’ - ε-globin,
US:
5’- GTCAGCAGTGATGGATGGAC –3’, DS: 5’- TGCAGATAGATGAGGAGCCA –3’ - γ-globin,
US:
5’- CCTTCAGCAGTTCCACACAC -3’, DS: 5’- CTCCTCTGTGAAATGACCCA -3’ - Mouse HS2, US:
5’- ATCTGGCCACACACCCTAAG -3’, DS: 5’- TGCAGTACCACTGTCCAAGG -3’ - βmajor-globin, US:
5’- AAGCCTGATTCCGTAGAGCCACAC -3’, DS: 5’- CCCACAGGCAAGAGACAGCAGC -3’ - ε/γ-globin, US: 5’- TCTTTGAAGCCATTGGTCAGC -3’,DS: 5’- ATGACCTGGCTCCACCCAT -3’
DNA was quantitatively analyzed using real-time PCR technique in the myiQ single color real-time PCR detection system from Biorad.
Antibodies used for the procedures noted above include: USF1 (M-86) sc-8983, USF2 (N-18) sc-861, HDAC3 (H-99) sc-11417, CBP (A-22) sc-369, GAPDH and p300 (N- 15) sc-584 (all purchased from Santa Cruz Biotechnology); Suz12-ChIP Grade (ab12073) and Mouse monoclonal to Histone H3 (tri methyl K27) (ab6002) from abcam; IgG C6409 (antichicken Iga; Sigma); anti-TFII-I (a gift from R. G. Roeder, Rockefeller University); and anti-HDAC3 (a gift from E. Seto, University of South Florida).
RESULTS
TFII-I recruits co-repressors to the β-globin gene locus
It was previously shown that TFII-I and USF1 both bind to the β-globin gene at its initiator/E-box element, which contains the transcription start site.11 Figure 4 clearly demonstrates that USF1 interacts with TFII-I and another member of its own family, USF2, in both K562 and MEL cells. USF1 interacts more strongly with TFII-I in K562 cells, where β-globin expression is repressed, versus MEL cells. On the other hand, USF1 interacts prominently with USF2 in MEL cells, where the β-globin gene is actively expressed, compared with K562 cells. Similar experiments using an antibody against USF2 for immunoprecipitation and a USF1 antibody for Western blotting yielded the same results. All three proteins are expressed in both cell lines at comparable (or similar) concentrations .20 This lends further credence to the idea that TFII-I acts in a repressive manner at the β-globin locus, whereas USF1 acts as an activator.
Figure 3. Coimmunoprecipitation experiments demonstrating interactions between USF1 and the proteins TFII-I and USF2. K562 and MEL cell lysates were subjected to immunoprecipitation with antibodies directed against USF1. Protein complexes were captured with anti-rabbit IgG beads. Complexes were eluted off with Laemmli buffer and loaded onto 10% Ready Gels (Bio-Rad). After transfer, the membrane was cut into strips. Strips were probed with antibodies against USF1, USF2, and TFII-I. The strips were then reassembled before phosphoroimaging. The panel on the right represents 20 μg of whole cell K562 and MEL extracts that were run on a gel and probed with an antibody against TFII-I.
Previous studies have indicated that TFII-I interacts with histone deacetylases 3 (HDAC3).13 Experiments were conducted in K562 cells to determine whether these interactions occur in erythroid cells. Co-immunoprecipitation (Co-IP) experiments indicate a strong interaction between TFII-I and HDAC3 in K562 cells and no interactions in MEL cells (Figure 4).
Figure 4. Characterization of TFII-I interacting proteins. Coimmunoprecipitation experiment indicating interactions between TFII-I and HDAC3 in K562 cells. K562 and MEL whole cell extracts were obtained with NP-40 lysis buffer and precleared with anti-rabbit IgG beads (eBioscience). Lysates were then immunoprecipitated with an antibody against HDAC3 or IgG. The precipitated complexes were captured by anti-rabbit IgG beads and eluted off with Laemmli buffer. They were heat denatured and run on a 7.5% denaturing polyacrylamide gel and transferred to a membrane. The membrane was blotted with an antibody against TFII-I before phosphorimaging.
Similar experiments were
performed to detect a possible interaction between TFII-I and Suz12
at the β-globin locus in K562 cells.
First, a ChIP experiment was performed to determine whether Suz12 interacted
with the β-globin promoter region. Suz12 is shown to interact
at the adult β-globin promoter in K562 cells and not in MEL cells.
Subsequently, a CoIP was performed to demonstrate that TFII-I interacts
with Suz12 significantly more in K562 cells than MEL cells (Figure
5B). GAPDH and GATA1 were used as controls in the experiment. This
data cumulatively suggests that TFII-I does in fact act as a repressor
for β-globin expression and recruits HDAC3 and Suz12 to the promoter
to aid in this repression.
Figure 5. Understanding interactions between TFII-I and Suz12. (A)ChIP experiment was performed on K562 and MEL cells, which were immunoprecipitated using antibodies against IgG, H3MeK4, Suz12, H3K27Me3, and no antibody. The DNA precipitates from the samples, including input, were subjected to PCR using primers specific for the εγ- and βmajor- globin gene promoters. (B) CoIP was performed on K562 and MEL whole cell extracts using anti-rabbit IgG beads (eBioscience) to preclear the lysates before immunoprecipitating with two concentrations of an antibody against Suz12, GAPDH, and GATA1. Protein complexes were captured with the same beads and eluted off with Laemmli buffer (Bio-Rad) and denatured before being loaded onto a 7.5% gel. Proteins were then transferred to a membrane that was subject to blotting using an antibody against TFII-I, and thereafter, phosphorimaging.
USF1 recurits co-activators to the β-globin gene locus
Previous data has shown that both helix-loop-helix proteins USF1 and USF2 interact with the β-globin distal E-box.4 Figure 3 demonstrates that these two proteins interact very strongly in MEL cells compared to K562 cells, indicating that the USF1/USF2 heterodimer may be interacting with the +60 E-box of the β-globin gene to activate expression of the adult β-globin gene. CBP and p300 have been shown to be recruited to the chicken HS’4 element of the β-globin gene locus by USF.22 Two techniques were used to determine whether CBP and p300 interact with the β-globin promoter and the protein USF1. ChIP experiments (Figure 6A) reveal that these two proteins associate with the LCR HS2 element in K562 cells. However, CBP and p300 are noted to associate strongly with the β-globin promoter in MEL cells. p300 is found to associate 10-22 times more strongly with the β-globin promoter than a control epitope. CBP is noted to associate about 4-10 times more strongly with the β-globin promoter when compared to a negative control epitope. CoIP experiments were subsequently used to determine whether these proteins also interacted with the protein USF1 when β-globin expression was active (Figure 6B and 6C). Results indicate that p300 and CBP are expressed at about the same levels in both K562 and MEL cells and interact with each other in both cell lines, as expected. Furthermore, strong interactions between USF1 and p300 (Figure 6B) and USF1 and CBP (Figure 6C) are observed in MEL cells, whereas no such interactions were detected in K562 cells. These data imply that USF1 acts as an activator for β-globin expression and performs at least part of its function by recruiting the co-activators CBP and p300 to the β-globin promoter.
Figure 6. Characterization of USF1 interacting proteins. (A) ChIP experiments conducted in K562 and MEL cells. Antibodies against IgG, PCAF, SET 7/9, CBP, p300, and no antibody were used to precipitate cross-linked DNA. The precipitates, including input, were subjected to PCR analysis using primers specific for εγ- and βmajor-globin promoters and the HS2 element of the LCR. (B) CoIP experiments were performed on whole cell protein extracts from K562 and MEL cells. Extracts were precleared with anti-rabbit IgG beads and subjected to immunoprecipitation using 5μg of antibodies against USF1, p300, CBP, and HDAC3. These protein complexes were captured using anti-rabbit IgG beads and eluted off with Laemmli buffer and denatured with heat. Eluates were loaded onto a 5% polyacrylamide denaturing ready gel. Proteins were then transferred to a membrane, which was blotted with antibody against p300 before phosphorimaging was done. (C) Membrane from part B was stripped and reprobed with an antibody against CBP.
DISCUSSION
Tissue- and development-specific expression of the β-globin like genes requires precise interplay between trans-acting proteins and cis-acting DNA regulatory enhancer and promoter elements. The order and acuity with which transcription regulators bind to specific sites on the gene locus determine chromatin accessibility of a specific gene, which ultimately results in the recruitment of transcription complexes to the site of action.
Three transcription factors involved in globin locus regulation are TFII-I, USF1, and USF2. Part of the helix-loop-helix family, these proteins have been established to bind to the initiator element/E-box located at and downstream of the transcription start site. Another E-box element located 60 bp downstream of the transcription start site was shown to interact with USF in cells expressing β-globin.11 Other studies have shown that USF also interacts with a functionally important E-box motif in the HS2 element of the LCR.23 Also, TFII-I has been shown to act as a repressor for β-globin expression while USF1 and USF2 act as activators.7 This study analyzes protein-protein interactions through which these two proteins appropriately regulate β-globin expression in K562 and MEL cells. K562 cells are human erythroleukemia cells that exhibit an embryonic environment. They predominantly express the ε- and γ-globin genes. MEL cells are murine erythroleukemia cells that express only the adult βmajor- and βminor-globin genes, representing an adult environment. Results from this study confirm interactions between TFII-I and HDAC3 as noted in previous studies.13 These interactions were significantly stronger in K562 cells than MEL cells. The protein Suz12 was also shown to bind to the β-globin promoter in K562 cells and was shown to interact strongly with TFII-I in K562 cells compared with MEL cells. Suz12 is known to be a core element in the polycomb group of proteins PRC2 complex, which acts as a repressor of many genes in an embryonic environment.16 Combined, these results demonstrate that TFII-I functions as a repressor for the β-globin gene by recruiting histone deacetylase activity and a member of the repressive polycomb group protein complex 2 to the promoter in an embryonic environment.
It was previously demonstrated that USF proteins regulate β-globin gene expression.22 This study shows that a clear interaction between USF1 and the regulators p300 and CBP was detected much more strongly in MEL cells, which express β-globin, when compared with K562 cells. Furthermore, CBP and p300 were found to associate with the β-globin locus and the HS2 element of the LCR in MEL cells, and only HS2 in K562 cells. The data presented here suggest that USF1 functions as an activator of β-globin expression in a heterodimer with USF2 by recruiting histone acetylase activity provided by co-regulators CBP and p300 to the β-globin promoter to aid in activation of expression of this gene. A model of all protein interactions regulating transcription of the β-globin gene is shown in Figure 7.
Figure 7. Diagrammatic representation of the regulation of the expression of β-globin by helix-loop-helix proteins TFII-I and USF and their respective coregulators. The β-globin locus consists of a TATA-like element (CATA), an initiator element, and an E-box located 60 bp downstream of the transcription start site. This study proposes that TFII-I recruits the proteins HDAC3 and Suz12 to the initiator element to aid in repression of the β-globin gene in an embryonic environment. However, when β-globin is expressed in an adult environment, USF1 recruits histone acetylases p300 and CBP to the distal E-box to act as co-activators for the gene.
Further studies must be done to confirm the roles TFII-I and USF1 play in β-globin gene regulation, respectively. Also, K562 and MEL cells do not accurately depict erythroid cells that differentiate during human and mouse development. Thus, an animal model in which the activity of USF and TFII-I could be reduced in erythroid cells would be important. Observing the phenotypic and genotypic changes in these transgenic mice would confirm the functional roles dictated for USF1 and TFII-I from this and previous studies.
In summary, the data presented suggest that the transcription factors USF1/USF2 and TFII-I regulate β-globin gene expression by recruiting epigenetic modifying proteins to the promoter to alter the state of chromatin accessibility around the β-globin locus. These protein complexes work together with other chromatin remodeling proteins and erythroid-specific transcription factors to form a complex mechanism through which the β-globin gene is accurately expressed in a developmental, stage-specific manner.
ACKNOWLEDGEMENTS
I would like to thank Dr. Jörg Bungert and Valerie Davis for their patience and encouragement during my scientific training. This work was supported by the University of Florida University Scholars Program and the Bungert Lab.
REFERENCES
- Levings PP, Bungert J. The human beta-globin locus control region. Eur J Biochem. 2002;269:1589-1599.
- Forrester WC, Takegawa S, Papayannopoulou T, Stamatoyannopoulos G, Groudine M. Evidence for a locus activation region: The formation of developmentally stable hypersensitive sites in globin-expressing hybrids. Nucleic Acids Res. 1987;15:10159-10177.
- Bulger M, Groudine M. Looping versus linking: Toward a model for long-distance gene activation. Genes Dev. 1999;13:2465-2477.
- Leach KM, Vieira KF, Kang SH, et al. Characterization of the human beta-globin downstream promoter region. Nucleic Acids Res. 2003;31:1292-1301.
- Du H, Roy AL, Roeder RG. Human transcription factor USF stimulates transcription through the initiator elements of the HIV-1 and the ad-ML promoters. EMBO J. 1993;12:501-511.
- Roy AL, Meisterernst M, Pognonec P, Roeder RG. Cooperative interaction of an initiator-binding transcription initiation factor and the helix-loop-helix activator USF. Nature. 1991;354:245-248.
- Chimge NO, Mungunsukh O, Ruddle F, Bayarsaihan D. Expression profiling of BEN regulated genes in mouse embryonic fibroblasts. J Exp Zoolog B Mol Dev Evol. 2006.
- Desgranges ZP, Ahn J, Lazebnik MB, et al. Inhibition of TFII-I-dependent cell cycle regulation by p53. Mol Cell Biol. 2005;25:10940-10952.
- Youn H, Koo Y, Ji I, Ji TH. An upstream initiator-like element suppresses transcription of the rat luteinizing hormone receptor gene. Mol Endocrinol. 2005;19:1318-1328.
- Hakimi MA, Dong Y, Lane WS, Speicher DW, Shiekhattar R. A candidate X-linked mental retardation gene is a component of a new family of histone deacetylase-containing complexes. J Biol Chem. 2003;278:7234-7239.
- Leach KM, Vieira KF, Kang SH, et al. Characterization of the human beta-globin downstream promoter region. Nucleic Acids Res. 2003;31:1292-1301.
- Ogura Y, Azuma M, Tsuboi Y, et al. TFII-I down-regulates a subset of estrogen-responsive genes through its interaction with an initiator element and estrogen receptor alpha. Genes Cells. 2006;11:373-381.
- Tussie-Luna MI, Bayarsaihan D, Seto E, Ruddle FH, Roy AL. Physical and functional interactions of histone deacetylase 3 with TFII-I family proteins and PIASxbeta. Proc Natl Acad Sci U S A. 2002;99:12807-12812.
- Gray SG, Ekstrom TJ. The human histone deacetylase family. Exp Cell Res. 2001;262:75-83.
- Tussie-Luna MI, Bayarsaihan D, Ruddle FH, Roy AL. Repression of TFII-I-dependent transcription by nuclear exclusion. Proc Natl Acad Sci U S A. 2001;98:7789-7794.
- Boyer LA, Plath K, Zeitlinger J, et al. Polycomb complexes repress developmental regulators in murine embryonic stem cells. Nature. 2006;441:349-353.
- Lee TI, Jenner RG, Boyer LA, et al. Control of developmental regulators by polycomb in human embryonic stem cells. Cell. 2006;125:301-313.
- Crusselle-Davis VJ, Vieira KF, Zhou Z, Anantharaman A, Bungert J. Antagonistic regulation of {beta}-globin gene expression by helix-loop-helix proteins USF and TFII-I. Mol Cell Biol. 2006;26:6832-6843.
- Corre S, Galibert MD. Upstream stimulating factors: Highly versatile stress-responsive transcription factors. Pigment Cell Res. 2005;18:337-348.
- Roy AL, Du H, Gregor PD, Novina CD, Martinez E, Roeder RG. Cloning of an inr- and E-box-binding protein, TFII-I, that interacts physically and functionally with USF1. EMBO J. 1997;16:7091-7104.
- Sirito M, Lin Q, Maity T, Sawadogo M. Ubiquitous expression of the 43- and 44-kDa forms of transcription factor USF in mammalian cells. Nucleic Acids Res. 1994;22:427-433.
- Blobel GA. CBP and p300: Versatile coregulators with important roles in hematopoietic gene expression. J Leukoc Biol. 2002;71:545-556.
- Elnitski L, Miller W, Hardison R. Conserved E boxes function as part of the enhancer in hypersensitive site 2 of the beta-globin locus control region: role of basic helix-loop-helix proteins. J Biol Chem. 1997;272:369-378.
Back to the Journal of Undergraduate Research







